All India Network Project on Vertebrate Pest Management

A. RODENT PEST MANAGEMENT

Central Arid Zone Research Institute, Jodhpur (Rajasthan)

• In cold arid regions of Leh-Ladakh Five rodent species were reported from different altitudes and habitats in and around Leh, viz., Mus booduga(crop fields and rural storage),Rattusturkastenicus(shops, godowns and kitchen garden), Pitymysleucurus(grasslands),and Marmota himalayana (grasslands and barren lands)andRattussp(outskirts of Leh city).M. booduga, reported for the first time was widely distributed, as it was recorded from five habitats predominantly from crop fields where it caused 14-16% damage to barley and wheat crops at harvest stage. Burrow systems of these rodents were also studied.
• With increase in irrigation facilities, through Narmada canal (in south- western Rajasthan) leading to diversification and intensification of agriculture has provided very conducive environment to the rodents resulting into increased rodent diversity and abundance in irrigated crops fields. Nine rodent species viz, Tateraindica, Millardiameltada, Rattusrattus, Golundaellioti, Funambuluspennanti, Merioneshurrianae, Mus musculus, M. boodugaandNesokiaindicawere reported and of theseM. boodugaand N. indica were trapped for first time from the Narmada canal command area.
• Change in land use pattern from rain fed to irrigated cropping in the Narmada Canal Command area has shown replacement of xeric species viz, GerbillusGleadowiandMerioneshurrinaewith sub-mesic and mesic species (Mus booduga, Nesokiaindica, MillardiameltadaandGolundaelloiti) and commensal species (Rattusrattus, Mus musculus).
• In rann of Kutchh (Gujarat) burrows of M. booduga and T. indica were observed, whereas in hilly tract Cremnomyscutchicus were trapped, whereas, T. indica, Golundaellioti and Millardiameltada were trapped from cultivated fields.
• Treatment with zinc phosphide bait (on day one) and bromadiolone bait (on day 4th) followed by need based treatment of bromadiolone bait yielded 83.11 and 82.20% rodent control success, respectively in cumin and ground crops.
• Baiting with bromadiolone bait (0.005%) in godowns infested with MusboodugaandRattusturkestaknicusinLehprovided significant rodent control success.
• Training and demonstration on Rodent Pest Management was organized for farmers of villages, three village of Jodhpur District and two villages of Jalore and Nagaur Districts. Under Tribal Sub Plan of AINP on VPM ten field training on “Rodent Pest Management was conducted in two tribal villages of Distt. Banswara (Rajasthan), two villages of Leh (J&K) and four villages in Distt. Sirohi, Dungarpur. More than 360 tribal farmers benefited from the training. Besides, farmers from the adopted villages of KVK, Jodhpur visited the laboratory and were briefed about the importance of rodents in agriculture and management techniques. Lectures on Rodent Pest Management were delivered in on campus trainings organized by KVK and radio talks were delivered on AIR, Jodhpur.

Resource Generation:

During the period a total of 11 contract service projects on anti-rodent testing of DWC a sum of Rs.43, 63,091.00 was generated as a resource for the Institute.

Punjab Agricultural University, Ludhiana (Punjab)

• Rodent pests in rice-wheat-vegetable cropping system in Punjab revealed predominance of Bandicotabengalensis followed by Tateraindica,MusboodugaandGolundaellioti (with a trap index between 5.10 - 37.50)
• A stable ready to use zinc phosphide bait was developed and tested for its efficacy under both laboratory and field conditions.
• Laboratory studies revealed both primary and secondary repellent effects of 2.5% methyl anthranilate (MA) under bi-choice conditions. Application of microencapsulated 2.5% MA prevented rodent attack on small stacks of wheat bags for 28 days. Efforts are being made to further improve the efficacy of MA as repellent against rodents.
• Laboratory studies revealed both antifeedant and antifertility effects of Neem seed extract against Bandicotabengalensis. Formulations of neem seed extract have been developed.
• Studies on capsicum oleoresin revealed antifeedant effect of 3 and 5% concentrations under laboratory, simulated storage and simulated field conditions.
• Microcapsules containing 5% citronella oil were found effective in reducing damage caused by Rattusrattus to wheat bags under simulated storage conditions.
• Surveyed villages like Noorpur Bet, Khaira Bet, Barnhara, Atiana and Rajoana of district Ludhiana where blue bulls are causing severe damage to crops and interacted with farmers.
• Adopted villages like Barnhara, Jainpur and Malikpur as maintenance, neglected and survey villages and imparted education to farmers regarding rodent pest management technologies.
• Surveyed wheat crop sown under different methods of rice residue management like surface mulching, standing stubbles and stubble incorporation in districts Ludhiana, Sangrur, Ferozepur and TaranTaran Sahib for rodent infestation and damage. More damage was found in fields with rice straw mulching.

AP Rice Research Institute, RARS (ANGRAU), Maruteru (Andhra Pradesh)

• Rodent incidence in Godawari Delta region of AP was very low during years 2017-19. Corresponding to the rodent incidence, the damage to the crop was also found below the ETL (<4% tiller damage) during these years. Though the rodent infestation hover around medium, the mean tiller damage was found very low with 2.9 and 0.98 percent in 2017-18 and 2018-19, respectively.
• Rodent species composition in High Altitude and Tribal Zone of Andhra Pradesh revealed predominance of Rattusrattus in HAT Zone (90.25%) followed by B. bengalensis (6.66%).
• An ecologically based non-chemical rodent management technique i.e. Trap Barrier System (TBS) was developed against Bandicotabengalensis in irrigated rice ecosystem.
• Developed thumb rules and rodent forewarning models on incidence of lesser bandicoot, B. bengalensis in rice in Godavari delta of Andhra Pradesh.
• Conducted studies on liquid baits for improving the poison bait intake in food surplus environs and achieved 83.3% population reduction with 62% bait intake.
• Tested and identified the potential botanicals i.e., Datura and Nerium against bandicoots and house rat. De-hulled maize cobs powder was tested and identified as low cost baiting material for rodenticide poisoning.
• Rodent pest management modules were tested against rodents in rice and effective module comprising cultural practices- ZNP baiting-Bromadiolone baiting –ALP was identified with a control success of 69.8%.
• Increased mean mortality time upto 15-20 days was recorded in field collected lesser bandicoots at recommended (0.005%) and half the recommended (0.0025%) dosages of bromadiolone offered in cereal based baits.
• Mass Rodent control campaign on community basis was organized in the village Kommuchikkala (2017-18 and 2018-19) in rice fields during Tillering stage of the crop. The per cent rodent control success of over 80% was achieved.

Assam Agricultural University, Jorhat (Assam)

• Studies on species composition of rodents in rice-vegetables cropping system revealed the presence of 4 species viz., Bandicotabengalensis, B. indica, Mus booduga, Rattussikkimensis, out of which the B. bengalensis was found to be the most predominant species with the highest mean number (6.11) and persistent species in rice-vegetables cropping system followed by B. indica(1.67), M. booduga(1.11) and R. sikkimensis (0.25).
• The species composition of field rodents in kharif rice in rice-vegetables cropping system throughout the different growth stages of rice revealed that Bandicotabengalensis was the most predominant species with 67.79-74.68% abundance followed by Mus booduga(11-15%), Bandicotaindica(8-10%), Rattussikkimensis(3-5%) and Dremomyslokriahmacmillani(2-3%).
• Botanicals herbs like Azadirachtaindica seed kernel and Capsicum chinense have good repellent effect on B. bengalensis. The A. indicaseed kernel showed the strongest repellency index (65-66%) followed by C. chinense (49-50%).
• Botanicals like Carica papaya, Solanumkhasianum, Ananascosmosus, MoringaoleiferaandAzadirachtaindica seed kernel have shown good antifeedant effect on Bandicotabengalensis. Among the botanicals, M oleifeara showed the highest antifeedant index (64-65%) followed by S. khasianum (62-63%.
• Rodent management module in rice viz. cultural practices (removal of weeds/bushes)+application of ecodon (1:20) on bunds at tillering stage + bromadiolone (0.005%) baiting at PI stage + trapping with local bamboo traps @ 50 traps/ha at ripening stage +smoking in live burrows with egg tray plates at harvest) was found most effective module resulting in 64.66-68.8% reduction in rodent population in kharif rice and 52.21-56.67% reduction in rodent population in rabi vegetables ,respectively.
• Installation of barn owl nest boxes in fields yielded a rodent control success of 67.02%, 48.12%, 41.75% and 31.13% in vegetables, wheat, rice and mustard, respectively.

University of Agricultural Sciences, Bengaluru (Karnataka)

• Newer rodenticides, vizdifenacoum and flocoumafen, have been tested with 100% control success in coconut, 91.0% in paddy, 73.89% in soybean and 85.76% in storage conditions. While flocoumafen, recorded rodent control of 100% in coconut, 91.7% in paddy, 81.26 % in soybean and 83.24% in storage. Hence, these two rodenticides can be used against rodent pests in these crops, in future after registration.
• Wonder traps followed by glue traps and snap traps were found superior in catching of rodents under storage conditions with success rate of 71.14,
• Baiting with 2% zinc phosphide bait followed by placement of bromadiolone wax blocks reduced the rodent damage and rodent density in poly houses, effectively.
• In Grape gardens Zinc phosphide (2%) baiting followed by bromodiolone baiting, was found effective in managing the rodent pest’s with success rate of 88.64 per cent.
• In coconut, trunk banding technology proved very effective in controlling rodent pests; the cost of polythene sheet wrapping, is Rs.2000/ha and zinc sheets is 6000/ha and polyethene sheet wrapping is viable up to 2-3 years, while zinc sheet is viable for <10 years.
• Zn3P2 (2%) baiting at germination stage following by Al2(PO3)2 application in burrows at peg formation stage resulted in 76 per cent reduction in burrow counts with C: B ratio of 1:21.
• Jack fruit, and dry fish were the best attractants and were effective in trapping a greater number of Bandicotaindica.
• Placement of rodenticides at crown region reduced rodent pests with 80-85 per cent in areca plantations, then placement on ground region (10-20% control).
• In coffee plantations difenacoum and flocoumafen was found effective with reduction of 79.27 and 73.4 per cent rodent damage, respectively.

Kerala Agricultural University, Thrissur (Kerala)

• For monitoring and control of rodents through traps in deep water rice fields in Kerala, Thanjavur kitty performed well when the water level was low (42% trapping success), however, Moncombu trap proved superior in the inundated rice fields (56% trapping success). Sherman trap, snap trap and live trap worked well on the rice field bunds (35, 25 and 19%, respectively). Major rodents caught during the study were Mus booduga,Rattusnorvegicus and Bandicotabengalensis. Rodent damage was maximum at tillering and reproductive stages.
• Coconut and cacao, harbored roof rats and squirrels (giant and three striped) in various proportions. Porcupines were observed in fields of cucurbit & Tomato, fodder grasses and cashew plantations. Two species of squirrels viz., Malabar giant squirrel (in cashew, mango and coconut orchards) and three stripped squirrels (in Mango and cacao orchards) were also encountered in this region. The Asiatic long tailed tree mouse and brown spiny mouse were noticed in cucurbit and tomato fields.
• Rodent damage assessment in rice done in Palakkad and Thrissur districts revealed up to 11% tiller damage. Among the rice varieties, Uma suffered the maximum damage (11%) by the rodent attack followed by Jyothi (8%) and variety Sreyas had the least (1.13%) damage.
• To manage the rice field rodents, coconut leaf petiole was placed as owl perches @ 20 per acre to attract the barn owls. Motor engine oil @ 2 per cent was mixed with water while irrigating the field to repel the rats. Following other rat management techniques were used in rice fields at different situations • Field sanitation around the cropped field especially the field bunds and closing rat burrows on bunds before sowing which reduced the seed picking by rodents from the nursery and direct sown rice crop • Burrow smoking with pepper or chilli powder which scarred and repelled off the resident rodents from the hide outs • Growing of plants viz., Echitesmalabaricus(Palvally - Ichnocarpusfrutescens), Plumbagorosea and Vetiveriazizanioideson the bunds repel the rats to some extent • Mixing the rice seeds with 50 kg powdered neem cake at the time of sowing reduced the rodent damage • Spraying kerosene emulsion or motor oil emulsion (@ 2%) on the bunds reduced the rodent damage in the field • Anticoagulant cakes found better than the acute poison like zinc phosphide. The visceral mass of apple snail (Pila globosa) found to be good bait for the rice field rodents. Other baits used were, peanut butter, coconut gratings and tapioca roots • Mixing egg white (2ml) with zinc phosphide (2g) in an empty molluscan shell was found to be accepted by the rodents.
• Rodent management in cocoa: (i) Harvesting of matured pods was recommended to reduce the incidence of rodents in homesteads, (ii)Use of Sherman and snap traps on tree trunks, (iii) Cutting down border trees with the cocoa plants (iv) Zinc phosphide bait with peanut butter was readily accepted by rats in cocoa plantation.
• Molecular characterization of Rattus species was completed.

B. Agricultural Ornithology

PJT State Agricultural University, Hyderabad (Telangana)

• Total 16 species of the plants were identifiedinfrugivorus category. Among the species Pithecellobiumdulce, Phoenix sylvestris and Ficusracemosa are attracting highest number of birds16, 14 and 13 respectively. Rose ringed parakeet stands high with occurrence of 34 on Ficusreligiosa, Butea monosperma (22) and Pithecellobiumdulce (21). Phenological events of different trees indicated utilization of birds throughout the year either for flower or fruit trees.
• The overall percent damage by depredatory birds on different crops in Telangana revealed high incidence of damage in sunflower during milky stage (18-46%) followed by sorghum (20-44%), Pearl millet (18-35%), safflower (09-15%), maize (05-31%), and paddy (03-05%). Whereas, during sowing and sprouting stage, the incidence of damage was high in Maize (20-46%) and sunflower (2 - 5%).
• In Grapes, recommended erection of gunny bags and reflective ribbons along the rows in the y system of planting reduce incidence of damage by birds.
• Fixing of jute rope around the crop, with the help of pegs in 1 m intervals and 1 foot above ground lying the rope in the entire crop during sprouting stage in checkered pattern prevent entry of Peafowl into the crop fields was recommended.
• For the first time in the country, standardized and recommended the nest boxes design for cavity nesting birds in controlling insects & rodent’s pests of various crops.
• Spreading of fish net in 3ft width from the bund in to the water, fixing with poles around the pond reduces bird damage to 60-70% during seedling & harvesting stages of the fish and prawns.
• Recommended NPV (250 LE/ha) and Bird perches (@ 20 /acre) in pigeon pea, groundnut, chick pea, castor and vegetable crops to control insect pests.

Anand Agricultural University, Anand (Gujarat)

• Total 52 bird species were recorded from four different habitats and highest species diversity was observed in crop lands (32) followed by wet lands (30), fallow lands (26) and Plantation crops (21). However number of birds were recorded highest in wetland ecosystem (833) followed by crop land (456), fallow land (140) and Plantation crop (116).
• During 2018-19, most occurred species were Ashy-crowned sparrow lark, Black drongo, Brahminy starling, Cattle egret, Common myna, Crested lark, Green bee-eater, Jungle babbler, Red-vented bulbul, Sarus crane and Yellow wagtail. Relative abundance of crested lark was highest and followed by Rosy starling, Wire-tailed swallow and Yellow wagtail.
• Total 548 Sarus were recorded from Gujarat state with highest number of Cranes recorded at Gobarapuratalav (150 cranes) of Limbasitahsil followed by Kanewal (1231) Out of total 548 cranes sighted were 492 adults and 56 juveniles.
• Eleven insectivorous bird species was recorded in tomato crop. 55-88 birds n open areas and 75-100 in perch area. The birds were recorded feeding on fruit borers.
• Out of 78 nest box 40 nest were occupied by Common myna, 2 nest were occupied by Brahminy starling, 2 nest were occupied by Oriental magpie-robin, 1 nest was occupied by House sparrow and 8 nest occupied by Squirrel. In all, almost 71 % nests were occupied in the first year of installation.
• Earthen nests, bird feeders and reflective ribbons were distributed to 65 tribal farmers at KVK, Vyara as a part of demonstration under tribal sub plan
• The demonstration on effectiveness of reflective ribbon to deter birds visiting crop fields were conducted. The demonstration on effectiveness of egg solution to deter birds visiting crop fields were also conducted.

Kerala Agricultural University, Thrissur (Kerala)

• Avian diversity in rice-rice system revealed occurrence of 72 species of birds which belonged to 27 families. Cattle egret was the most dominant bird (RA 9.32%) followed by pond heron (RA 6.40%). Depredatory birds viz., blue rock pigeon (RA 5.41%), baya weaver (RA 3.54%) and spotted munia (RA 2.28%) visited the crop field at the time of sowing, grain filling, maturity and harvest stages of the crop.
• Feeding deterrence of botanicals indicated that A. paniculata leaf extract was on par with the methyl anthranilite (0.2%), ecodon (1.0%), copper oxychloride (0.1%) and whole egg (1.0%) in reducing the feeding of parakeets. Among the aqueous extracts, leaf of Lantana camara (10 % aqueous leaf extract) had significantly reduced the feeding in munias.
• Use of metalized reflective ribbons against parakeets (rice) and peafowl in (cowpea) yielded 57-84% efficacy, whereas in pulses Nylon rope and metalized reflective ribbon fencing and Teak leaf protection provided over 90% protection from depredatory birds.
• Bio-ecology of purple moorhen (Porpyrio porphyria) and its management was studied in kole lands. The bird roosts on the bushy areas or marshy regions, where human interference was less. They were in abundance in the regions with invasive growth of water hyacinth. Even though it was a resident species, it had been reported in large numbers from the month of November and onwards. Among the different management strategies, roosting site clearance was the most effective followed by LED flash lights and netting. As the bird damage occurred even during after dusk period, reflective ribbon was not that effective.
• Metagenomics of bird fecal matter was studied for identification of useful virus and bacteria to suppress insect pests of crops. DNA isolation from the fecal pellet got standardized. Next generation sequencing technology had been carried out to analyse the microbial community within the species by isolation and polymerized chain reaction using 16S rDNA primer (16S rDNA f-GAGTTTGATCCTGGCTCAG and 16S rDNA r- ACGGCTACCTTGTTACGACTT). Sample was sequenced at SciGenom Labs Private Limited, Cochin (IlluminaMiSeq).The data generated by the study were being analyzed.

Punjab Agricultural University, Ludhiana

• Surveillance of depredatory birds in Rice, Wheat, Oil Seeds / Cereal Crops of Punjab revealed occurrence of 11depredatory bird species. Blue Rock Pigeon and House Crow were the most predominant species. Maximum damage was found in maturing stage of mustard but in the rice fields, the presence of Purple Moorhen and Indian Moorhen may causes up to 5.00% damage to the crop. In case of wheat the maximum damage ( upto 5%) occurred in initial stage of the crop.
• Studies on bird community structure n wheat crop field in western agro-climatic zone revealed a total of 22 species. Of this, Grey Wagtail and Red-wattled Lapwing were most abundant during the initial stages of the crop with an abundance of 20.38 and 20.00. Blue Rock Pigeon was the most predominant at maturing stage (69.23%).
• Ten species of birds were observed in moong crop fields. Small Bee-eater was most dominating species at initial stage while Blue Rock Pigeon was more abundant at vegetative stage. Red-wattled Lapwing and Blue Rock Pigeon were most abundant during the maturing stages of the crop with an abundance of 24-25% for both the species.
• Breeding biology of Black Drongo revealed that the breeding season of the species extended from May to August. The clutch size varied from 3-4 eggs. The average incubation period was of 13±0.34 days.
• Use of reflective tapes in Peas, Tomato, chilies, Mustard fields, provided 90-95% protection from birds damage. Similarly erecting nylon nets at seedling stages in cucurbits and pea crops provided 100% protection from bird damage.
• Using jute rope in the mustard crop at germinating stage reduced pea fowl damage to 2.1% as compared to 14% in control.
• Erecting “T” perches in barseem crop, a total of 19-23 bird species were recorded in different years. Mainly Bank Myna, Large Pied Wagtail, White-breasted Kingfisher, Black Drongo and Red-vented Bulbul were using the T perches installed in the crop fields during the initial stages of crop. Whereas Black Drongo, Red-vented Bulbul and Small Bee-eater were exploiting the “T” perches during the maturation of crop. Overhead electric wires were mostly exploited by Common Myna and House Crow during the surveyed period.

RARS, Assam Agricultural University, North Lakhimpur

• Surveys in different districts of Upper Brahmaputra Valley (UBV) and North Bank Plain (NBP) zones of Assam in Rice/Rice cropping system showed presence of 90 bird species belonging to 38 families. A total of 7181 individuals of birds were recorded in Lakhimpur district followed by 3994 in Sivasagar against. The species richness ranged from 15 to 82 in different districts and recorded highest in Sivasagar district with diversity index of 3.3.
• For Evaluation of bird roosting sites, habitat suitability index & impact in relation to different cropping systems,Higher Dropping Index (DI) of 31.6 was observed below the artificial nest boxes installed in the RARS field followed by Puja (23.6), Simul tree (22.6) and T- Perch of 9 feet height (21) installed for owl.
• A total of27 species (77.15 %) beneficial predatory bird species were recorded against only 8 species identified as depredatory species.Of these 60.28% (17 spp) were insectivorous; 20.06 % omnivorous (11 spp); 13.64% granivorous (4 spp) and 5.99% (2 spp) were recorded as frugivorous.
• Fourteen flowering and fruiting plant were identified those attract insectivorous and omnivorous birds. These plants serve the purpose of maintaining beneficial birds in the agro eco-system. 16 species of birds recorded in Mulberry followed by Bakul (Mimusopselengi) fruit (10).
• Large scale demonstration of T- Perch to provide artificial roosting sites in Sali (Kharif) paddy in 30 ha of rice field of tribal farmers (Boro tribe) and 20 ha of mustard field among tribal farmers. 500 Nest boxes for cavity nester birds. 2. Distributed 30 kg of Bird scaring Ribbon among Deuri tribe of Assam, 500 Nest boxes for cavity nester birds.
• A total of 141 bird species were recorded from Majuli islands that belonged to 14 family of which 57 spp are water birds. Among these species 39 found foraging in crop lands. The Orient1al White Ibis (NT) Threskiornismelanocephalus is the first report from Majuli recorded in crop field. Greater Adjutant Stork Leptoptilosdubius (EN) & Lesser Adjutant- Stork Leptoptilosjavanicus (VU) were also recorded in crop field of Majuli.A checklist on birds of DakhinpatSatra, Majuli – the biggest River Island of the world was also prepared.

C. HIGHER VERTEBRATES

• Call sequences for protection of crops from wild boar, Nilgai and Monkeys were developed and standardized and IOT based integrated bioacoustics gadget was developed. A provisional patent for IOT based integrated bioacoustic gadget was also filed by Hyderabad center that deters wild animals from the crop fields.
• This IOT based integrated bioacoustics gadget was also commercialized by PJTSAU, Hyderabad Center.
• In Karnataka, fencing with barbed wire and placement of HDEP nylon net in the border (3-4 feet height from the ground and 2 feet spread on the ground) increased the yield by 57 and 50 per cent over the control by reducing the wild boar menace in ground nut. Likewise, placement of Bio acoustic unit @ 2 to 3 per ha were found effective for the repellency of wild boar/ deer for 3 to 4 weeks in ground nut and other crops.
• Hyderabad center evolved as fencing technology involving fixing of the HDPE net (UV stabilized 2” mesh and 1.5mm thickness) using bamboo or wooden poles vertically for about 3-4 feet higher and spread horizontally about 2ft on the ground by using small wooden pegs to deter the wild boar entry.
• Erection of two feet circular continues wire mesh one feet away from the cropped area as border to protect the crop from wild boar.
• Bio fencing i.e., high density planting of castor with row-to-row 45cm and plant to plant 30cm and safflower with row to row 30 cm plant to plant 15 cm spacing around the main crop protect the crop from wild boar.
• Extent of damage by wild boar in various crops in Kerala revealed 3- 62 % damage. Coconut suffered maximum (62%) at nursery and fallen nuts stages. Amaranthus at vegetative stage and tapioca at tuber formation stage suffered 53 and 38% wild boar damage. Riec turmeric and coclocasia recorded least damage (3-4% only).
• To prevent wild boar entry into amaranthus crop field Nylon net fence was erected at a height of 120 cm feet with the support of poles and also spread over the ground surface about 90 cm and fixed firmly to the ground. Olfactory repellent ( Borep) with strong smell was taken in muslin cloth and tied on poles at a distance of 1m around the field at a height of 10 cm from the ground level. The method proved very effective reducing the crop damage to 6-12% as compared to 55-60% (in control).

D. DOCUMENTATION AND TRANSFER OF TECHNOLOGY

• Developed and published several Technical Bulletins booklets, pamphlets, brochures, and posters on different aspects on rodents, birds & wild boar and their management.
• Some notable bulletins are Bio-efficacy of Difenacoum and Flocoumafen in India; Barn Owl the rodent killer; Bio-ecology of lesser bandicoot rat, Bandicotabengalensis,( Grey and Hardwicke); Community Rodent Control Campaigns: The Andhra Pradesh Model; Cinnamic Aldehyde: An effective antifeedent/ Repellent for rodent pest management in grain stores; Current Status of bird management research in Punjab; Vertebrate Pest management Technologies in Agricultural landscape; handbook on Vertebrate Pests in Agricultural Landscape and Compendium of rodent population dynamics over three decades in major crops of Karnataka.
• Capacity building activities were undertaken by project scientists for different cadre of state Govt officials, scientists & farmers on various aspects of vertebrate pest management
• The centers organized number of on and off campus trainings, anti-rodent campaigns, exhibitions etc on vertebrate pest management. Also developed innovative awareness campaign materials for disseminating role of birds and wild boar in agricultural landscape.
• More than 150 publications were brought out in different National and International journals.
• Centers located in Rajasthan, Assam, Gujarat, Andhra Pradesh, Telangana, Karnataka and Kerala undertook extensive trainings, demonstrations and input supplies to tribal farmers of the state under TSP programme.

Web Template created with Artisteer.